AI & ChatGPT searches , social queries for YCC
What is the meaning of YCC. Phrases containing YCC
See meanings and uses of YCC!
What is the meaning of YCC. Phrases containing YCC
See meanings and uses of YCC!YCC
Topics referred to by the same term
YCC may refer to: National Young Composers Challenge Volvo YCC, a concept car from Volvo YCbCr a family of colour spaces used in video systems YCC, the
YCC
Female-designed Your Concept Car (2004)
The Volvo YCC ("Your Concept Car") is a concept car made by Volvo Cars presented at the 2004 Geneva Motor Show, with the stated goal of meeting the particular
Volvo_YCC
Large capacity cruiser motorcycle
carbureted Yamaha V-Max, the fuel injected VMAX uses YCC-I and YCC-T. Yamaha Chip Controlled Intake (YCC-I) is a new addition to the VMAX. The airhorns inside
Yamaha_VMAX
Topics referred to by the same term
YCCS may refer to: Youth Connection Charter School (Chicago) Yuba City Charter School Yacht Club Costa Smeralda (Porto Cervo) This disambiguation page
YCCS
Color space
xvYCC or extended-gamut YCbCr is a color space that can be used in the video electronics of television sets to support a gamut 1.8 times as large as that
XvYCC
Human Y-chromosome DNA haplogroup
major research groups came together and formed the Y-Chromosome Consortium (YCC). They published a joint paper that created a single new tree that all agreed
Haplogroup_J-M172
Monetary policy tool
Yield curve control (YCC) is a monetary policy action whereby a central bank purchases variable amounts of government bonds or other financial assets
Yield_curve_control
Human Y chromosome DNA grouping indicating common ancestry
haplogroup F-M89. The scientifically accepted one is the Y-Chromosome Consortium (YCC) one published in Karafet 2008 and subsequently updated. A draft tree that
Haplogroup_F-M89
Human Y-chromosome DNA haplogroup
YCC. E1b1a1a1f1 is defined by marker L514. This SNP is currently without population study data outside of the 1000 Genomes Project. E1b1a1a1f1a (YCC E1b1a7)
Haplogroup_E-M2
The Youth Citizenship Commission (YCC) was a commission created in the United Kingdom to promote youth participation in the political process and to foster
Youth_Citizenship_Commission
Type of motorcycle
has an electronically controlled clutch and gear shifting system called YCC-S. The clutch and transmissions of the AE/AS models are identical to that
Yamaha_FJR1300
Human Y-chromosome DNA haplogroup
S1a3b~ P401 (Based on the 2017 ISOGG tree, the 2015 ISOGG tree,) the 2008 YCC tree (Karafet 2008) and other published research.) Prior to 2002, there were
Haplogroup_S-M230
Human Y chromosome DNA grouping indicating common ancestry
major research groups came together and formed the Y-Chromosome Consortium (YCC). They published a joint paper that created a single new tree that all agreed
Haplogroup_E-M96
Sport motorcycle
the Yamaha Chip Control Intake (YCC-I) electronic variable-length intake funnel system, Yamaha Chip Control Throttle (YCC-T) fly-by-wire throttle system
Yamaha_YZF-R1
Human Y-chromosome DNA haplogroup
major research groups came together and formed the Y-Chromosome Consortium (YCC). They published a joint paper that created a single new tree that all agreed
Haplogroup_E-M215
Human Y chromosome DNA grouping common in North Eurasia
major research groups came together and formed the Y-Chromosome Consortium (YCC). They published a joint paper that created a single new tree that all agreed
Haplogroup_N-M231
Type of motorcycle
features multi-mode traction control system and electronic throttle control (YCC-T) with programs to support off-road use, switchable engine mapping, and
Yamaha_XT1200Z_Super_Ténéré
Human Y-chromosome DNA haplogroup
research groups united in 2002 to establish the Y-Chromosome Consortium (YCC). They published a joint paper that created a single new tree that all agreed
Haplogroup_J_(Y-DNA)
Sport motorcycle
engine-management system featuring the YCC-T ride by wire throttle and a multiplate slipper clutch. The 2008 model incorporated the YCC-I variable-length intake system
Yamaha_YZF-R6
Human Y-chromosome DNA haplogroup
major research groups came together and formed the Y Chromosome Consortium (YCC). They published a joint paper that created a single new tree. Later, a group
Haplogroup_D-M174
Human Y-chromosome DNA haplogroup
major research groups came together and formed the Y-Chromosome Consortium (YCC). They published a joint paper that created a single new tree that all agreed
Haplogroup_E-V38
Color space
sYCC is a standard numerical encoding of colors, similar to the CIE YCbCr encoding, It uses three coordinates: a luma value Y {\displaystyle Y} , that
SYCC
American paid youth work program
The Youth Conservation Corps (YCC) is a paid summer youth work program in federally managed lands. The National Park Service, US Forest Service, US Fish
Youth_Conservation_Corps
British politician (born 1983)
lecturers' plan to strike". The Guardian. "Youth Citizenship Commission". Ycc.uk.net. Retrieved 2 May 2010. "NUS president Wes Streeting: 'Moving to the
Wes_Streeting
Human Y-chromosome DNA haplogroup
major research groups came together and formed the Y-Chromosome Consortium (YCC). They published a joint paper that created a single new tree that all agreed
Haplogroup_A_(Y-DNA)
Highest peak of the Altai Mountains in Russia
Mūztau Şyñy [mʊsˈtɑw ʃəˈŋə]), or The Three Peaks (Altay: Ӱч-Сӱмер / Üç-Sümer [ʏc͡ç sʏˈmer]), is the highest mountain of the Altai Mountains and the highest
Belukha_Mountain
Human Y chromosome DNA grouping common in South Asia and the Mediterranean
haplogroup L-M20. The scientifically accepted one is the Y-Chromosome Consortium (YCC) one published in Karafet 2008 and subsequently updated. A draft tree that
Haplogroup_L-M20
Human Y chromosome DNA grouping found primarily in Asia
structure of haplogroup C-M130 subclades is based on the ISOGG 2015 tree, YCC 2008 tree and subsequent published research.) The distribution of Haplogroup
Haplogroup_C-M130
Football hooligan firm
The Minority and the youth firm are known as the Young City Casuals or 'YCC' along with the even younger group known as the 'Under 5's'. [citation needed]
Hull_City_Psychos
British political scientist
Retrieved 2011-03-15. Members Archived 2014-05-18 at the Wayback Machine. YCC website, accessed 18 May 2014. "Parliamentary Affairs". Archived from the
Jonathan_Tonge
Society of film critics in the Philippines
Desk of the Young Critics Circle (YCC) first gave its annual citations in film achievement in 1991, a year after the YCC was organized. In their Declaration
Young_Critics_Circle
Indian politician (born 1974)
2009 Member Samavaya Committee of Kozhikode DCC. Vice President, Kerala YCC, 2002 to 2006 President, Kerala YC Committee, 2006–08 Member of Kerala PCC
T._Siddique
Human Y-chromosome DNA haplogroup
major research groups came together and formed the Y-Chromosome Consortium (YCC). They published a joint paper that created a single new tree that all agreed
Haplogroup_A-L1085
Human Y-chromosome DNA haplogroup
J-M267 itself was recognized, for example J-M62 Y Chromosome Consortium "YCC" 2002. With one notable exception, J-P58, most of these are not common (Tofanelli
Haplogroup_J-M267
Kalispell in the same year. YCC (MCC) is a member of the Association for Biblical Higher Education (ABHE, Orlando). YCC is authorized by the Montana
Yellowstone_Christian_College
Human Y-chromosome DNA haplogroup
major research groups came together and formed the Y-Chromosome Consortium (YCC). They published a joint paper that created a single new tree that all agreed
Haplogroup_E-P2
Y chromosome haplogroup
GCAACAATGAGGGTTTTTTTG Primer R (Reverse 5′→ 3′): CAGCTCCACCTCTATGCAGTTT YCC HG: I1 Nucleotide alleles change (mutation): C to T Name: M307 Type: SNP
Haplogroup_I-M253
Car door hinged at the roof
the car rolled over, causing the door to fall off altogether. The Volvo YCC, a concept car designed by and for women, had gull-wing doors as part of
Gull-wing_door
Human Y chromosome DNA grouping indicating common ancestry
major research groups came together and formed the Y-Chromosome Consortium (YCC). They published a joint paper that created a single new tree that all agreed
Haplogroup_B-M60
Subgroup of a haplogroup in genetics
further subclades named using numbers and lower case letters (YCC longhand nomenclature). YCC shorthand nomenclature names Y-DNA haplogroups and their subclades
Subclade
Family of digital color spaces
separately for improved system efficiency. YCbCr is sometimes abbreviated to YCC. Typically the terms Y′CbCr, YCbCr, YPbPr, and Y′UV are used interchangeably
YCbCr
2007 Filipino film
Foster Child, also known as John John, is a Filipino indie pregnancy drama film produced by Seiko Films, which stars Cherry Pie Picache as a temporary
Foster_Child_(2007_film)
Haplogroup O. Human Y chromosome DNA grouping common in Asia
major research groups came together and formed the Y-Chromosome Consortium (YCC). They published a joint paper that created a single new tree that all agreed
Haplogroup_O-M175
Human Y-chromosome DNA haplogroup
major research groups came together and formed the Y-Chromosome Consortium (YCC). They published a joint paper that created a single new tree that all agreed
Haplogroup_E-M35
Three-wheeler motorcycle by Yamaha
shift system Traction control system (TCS) Driving mode switching function YCC electric throttle 4.8 U.S. gallons (18 liters) fuel tank The Niken arranges
Yamaha_Niken
US voluntary public work relief program, 1933–42
the opportunity to participate in conservation projects in a team setting. YCC programs are available in land managed by the National Park Service, the
Civilian_Conservation_Corps
Digital audiovisual data interface
optional. HDMI permits sRGB 4:4:4 chroma sampling (8–16 bits per component), xvYCC 4:4:4 chroma sampling (8–16 bits per component), Y′CBCR 4:4:4 chroma sampling
HDMI
Human DNA groupings
further subclades named using numbers and lower case letters (YCC longhand nomenclature). YCC shorthand nomenclature names Y-DNA haplogroups and their subclades
Human Y-chromosome DNA haplogroup
Human_Y-chromosome_DNA_haplogroup
Human Y-chromosome DNA haplogroup
major research groups came together and formed the Y-Chromosome Consortium (YCC). They published a joint paper that created a single new tree that all agreed
Haplogroup_E-M132
Descendant branch of haplogroup O1a (formerly O1)
major research groups came together and formed the Y-Chromosome Consortium (YCC). They published a joint paper that created a single new tree that all agreed
Haplogroup_O-M119
Human Y-chromosome DNA haplogroup
major research groups came together and formed the Y-Chromosome Consortium (YCC). They published a joint paper that created a single new tree that all agreed
Haplogroup_D-M15
Mountain in Georgia, United States
After the fire tower was taken out of service, a Youth Conservation Corps (YCC) crew dismantled the tower's uppermost component, a metal-framed enclosure
Rabun_Bald
Jewish summer camp school
The Harry Bronfman Y Country Camp (YCC), formerly known as the YM-YWHA Country Camp, is a Jewish summer camp in Huberdeau, Quebec. It affiliated with
Y_Country_Camp
Youth wing of the Indian National Congress
Archived from the original on 18 January 2013. Retrieved 24 January 2013. "YCC protests against killing of two Indian soldiers in Kashmir". State Times
Indian_Youth_Congress
High dynamic range color space
to ICTCP using another 3×3 matrix transformation. ICTCP was defined as a YCC digital format with support for 4:4:4, 4:2:2 and 4:2:0 chroma subsampling
ICtCp
Type of motorcycle
transmission with electable drive modes, called Yamaha Chip Controlled Shift (YCC-S). Wikimedia Commons has media related to Yamaha Majesty. Bond, Steve (November
Yamaha_YP400_Majesty
Human Y-chromosome DNA haplogroup
major research groups came together and formed the Y-Chromosome Consortium (YCC). They published a joint paper that created a single new tree that all agreed
Haplogroup_E-P177
Region of a protein's polypeptide chain
biology, YccV protein domain is also, alternatively named, Heat shock protein HspQ. This entry describes the small protein from Escherichia coli YccV and
HspQ_protein_domain
Human Y chromosome DNA grouping common in New Guinea
tree of haplogroup subclades is based primarily on the trees published by YCC in 2008 and ISOGG in 2016. M* (P256) M1 (M4, M5/P73, M106, M186, M189, M296
Haplogroup_M-P256
Production facility of Volvo Cars
GL City Taxi 242 GTC Turbo Tundra VCC LCP2000 ECC ACC SCC PCC PCC2 ACC2 YCC T6 3CC C30 Design Concept XC60 Concept ReCharge S60 Concept C30 DRIVe Electric
Volvo_Kalmar_Assembly
Human Y-chromosome DNA haplogroup
major research groups came together and formed the Y-Chromosome Consortium (YCC). They published a joint paper that created a single new tree that all agreed
Haplogroup_C-M217
Y-chromosome DNA Haplogroup O1b (formerly O2)
major research groups came together and formed the Y-Chromosome Consortium (YCC). They published a joint paper that created a single new tree that all agreed
Haplogroup_O-M268
CD-based format used for storing uncompressed photos
film negatives and transparencies. Both JPEG and JPEG 2000 support PhotoYCC colorspace as described below that is used in Photo CD files. The Kodak Pro
Photo_CD
Private university in New Haven, Connecticut, US
frequencies, they now have an Internet-only stream. The Yale College Council (YCC) serves as the campus's undergraduate student government. All registered
Yale_University
Philippine action drama film
Year Awards Category Recipient Result Ref. 1994 5th YCC Awards Best Achievement in Cinematography and Visual Design Jun Dalawis Charlie Arceo Won Best
Ikaw_Lang
Human Y-chromosome DNA haplogroup
major research groups came together and formed the Y-Chromosome Consortium (YCC). They published a joint paper that created a single new tree that all agreed
Haplogroup_E-M329
JPEG 2000 image encoder and decoder
meta-data full encode/decode support for monochrome, sRGB, palette, YCC, extended YCC, CIELab and CMYK colour spaces full encode/decode support for JPEG
Grok_(JPEG_2000)
Cross-referencing different names for Human Y chromosome DNA groupings
unmanageable communication barrier. In 2002, the Y-Chromosome Consortium (YCC) published a widely used proposal to standardize the naming of all Y-chromosome
Conversion table for Y chromosome haplogroups
Conversion_table_for_Y_chromosome_haplogroups
Philippine action drama film
Year Awards Category Recipient Result Ref. 1997 8th YCC Awards Best Screenplay Roy C. Iglesias Nominated Best Achievement in Film Editing Ferren Salumbides
Ganti_ng_Puso
2nd Miss Grand Myanmar competition, beauty pageant edition
Kanpetlet Miss Grand Bago 21 June 2023 at the Yangon Convention Center (YCC), Yangon 14 14 titles Miss Grand Bago Miss Grand Chauck Miss Grand Daik-U
Miss_Grand_Myanmar_2024
Filipino actor, model and producer (born 1977)
achievement in the Philippines. Pertaining to: the Young Critics Circle Film Desk (YCC), the defunct Entertainment Press Society, Inc. (EnPress) and the more recent
Allen_Dizon
Plug-in hybrid sports car
GL City Taxi 242 GTC Turbo Tundra VCC LCP2000 ECC ACC SCC PCC PCC2 ACC2 YCC T6 3CC C30 Design Concept XC60 Concept ReCharge S60 Concept C30 DRIVe Electric
Polestar_1
Regional Airport PU 15 Cornwall Regional Airport Commission 175 ft (53 m) CYCC YCC 45°05′34″N 74°34′04″W / 45.09278°N 74.56778°W / 45.09278; -74.56778 (Cornwall
List_of_airports_in_Ontario
Association football league in England
Reserves North Ormesby FC Richmond Town Reserves/Women Tees FC Whinney Banks YCC Huntington Rovers Guisborough Town Ladies Old Malton St Marys York Railway
North_Riding_Football_League
Human Y-chromosome haplogroup
major research groups came together and formed the Y-Chromosome Consortium (YCC). They published a joint paper that created a single new tree that all agreed
Haplogroup_E-M123
Concept car manufactured by Bertone
GL City Taxi 242 GTC Turbo Tundra VCC LCP2000 ECC ACC SCC PCC PCC2 ACC2 YCC T6 3CC C30 Design Concept XC60 Concept ReCharge S60 Concept C30 DRIVe Electric
Volvo_Tundra
Hospital in Connecticut, United States
Yale Cancer Center (YCC) was founded in 1974 as a result of an act of Congress in 1971, which declared the nation's "war on cancer". It is one of a network
Yale_Cancer_Center
Human Y-chromosome DNA haplogroup
major research groups came together and formed the Y-Chromosome Consortium (YCC). They published a joint paper that created a single new tree that all agreed
Haplogroup_E-M75
Wide color gamut RGB color space
clamped to the slightly larger −0.6038..7.5913. A 12-bit encoding called scYCC-nl is the conversion of the non-linear sRGB levels to JFIF-Y'CbCr and then
ScRGB
Sailing competition
are run in cooperation with the Offshore Racing Congress. ISAF Microsite YCCS ISAF Team Racing World Championship- History Archived 2020-09-19 at the Wayback
ISAF Offshore Team Racing World Championship
ISAF_Offshore_Team_Racing_World_Championship
Human Y-chromosome DNA haplogroup
isolated parts of Southeast Africa. The following phylogeny is based on the YCC 2008 tree and subsequent published research as summarized by ISOGG. E-Z827
Haplogroup_E-Z827
South Korean boy band
During the concert, they performed a new song titled "Young Creator Crew (YCC)" as a teaser for their upcoming second EP, with the track being heavily
Cortis
Y-chromosome DNA Haplogroup O2 (formerly O3)
major research groups came together and formed the Y-Chromosome Consortium (YCC). They published a joint paper that created a single new tree that all agreed
Haplogroup_O-M122
Human Y-chromosome DNA haplogroup
major research groups came together and formed the Y-Chromosome Consortium (YCC). They published a joint paper that created a single new tree that all agreed
Haplogroup_T-L206
Town and civil parish in Hampshire, England
Football Club". Retrieved 4 January 2025. "Yateley Cricket Club History". YCC. Retrieved 12 September 2017. "Welcome to the Frontpage". cranfordpark.hants
Yateley
GL City Taxi 242 GTC Turbo Tundra VCC LCP2000 ECC ACC SCC PCC PCC2 ACC2 YCC T6 3CC C30 Design Concept XC60 Concept ReCharge S60 Concept C30 DRIVe Electric
List of Volvo Car production plants
List_of_Volvo_Car_production_plants
Motor vehicle
GL City Taxi 242 GTC Turbo Tundra VCC LCP2000 ECC ACC SCC PCC PCC2 ACC2 YCC T6 3CC C30 Design Concept XC60 Concept ReCharge S60 Concept C30 DRIVe Electric
Volvo_Concept_You
United States federal agency
Archived from the original on September 20, 2016. Retrieved April 30, 2020. YCC Archived November 2, 2015, at the Wayback Machine PLC Archived November 2
National_Park_Service
Battery-electric compact luxury crossover SUV
GL City Taxi 242 GTC Turbo Tundra VCC LCP2000 ECC ACC SCC PCC PCC2 ACC2 YCC T6 3CC C30 Design Concept XC60 Concept ReCharge S60 Concept C30 DRIVe Electric
Volvo_EX60
Human Y-chromosome DNA haplogroup
major research groups came together and formed the Y-Chromosome Consortium (YCC). They published a joint paper that created a single new tree that all agreed
Haplogroup_E-V68
Swedish electric car brand
GL City Taxi 242 GTC Turbo Tundra VCC LCP2000 ECC ACC SCC PCC PCC2 ACC2 YCC T6 3CC C30 Design Concept XC60 Concept ReCharge S60 Concept C30 DRIVe Electric
Polestar
Battery electric luxury minivan
GL City Taxi 242 GTC Turbo Tundra VCC LCP2000 ECC ACC SCC PCC PCC2 ACC2 YCC T6 3CC C30 Design Concept XC60 Concept ReCharge S60 Concept C30 DRIVe Electric
Volvo_EM90
Motor vehicle
GL City Taxi 242 GTC Turbo Tundra VCC LCP2000 ECC ACC SCC PCC PCC2 ACC2 YCC T6 3CC C30 Design Concept XC60 Concept ReCharge S60 Concept C30 DRIVe Electric
Volvo_Philip
CC code CC number range number CC range ACC–YCC number range number range ACC–YCC County Antrim / Ballymena IA 1 to 9999 Dec 1903 – Mar 1932 1 to 9999
Vehicle registration plates of Northern Ireland
Vehicle_registration_plates_of_Northern_Ireland
Human Y-chromosome DNA haplogroup
major research groups came together and formed the Y-Chromosome Consortium (YCC). They published a joint paper that created a single new tree that all agreed
Haplogroup_E-P147
components. xvYCC: used in the video electronics of television sets to support a gamut 1.8 times as large as that of the sRGB color space. sYCC: uses two
List of color spaces and their uses
List_of_color_spaces_and_their_uses
Digital optical disc format
played on existing Blu-ray Disc players and have a larger color space using xvYCC. On January 14, 2013, Blu-ray Disc Association president Andy Parsons stated
Blu-ray
Regional Boy Scouts council in Massachusetts, U.S.
Lowell District formed the fifth spoke on the ship's wheel totem of the YCC council strip. The council operated two camps in its final years: Wah-Tut-Ca
Spirit_of_Adventure_Council
Swedish multinational manufacturer of luxury vehicles
(2002) Volvo ACC2 (2002) Volvo VCC – Versatility Concept Car (2003) Volvo YCC – Your Concept Car (2004) Volvo T6 (2005) Volvo 3CC (2005) Volvo C30 Design
Volvo_Cars
Musical artist
Awards 2018 – news.abs-cbn.com/entertainment". Retrieved June 11, 2018. "YCC picks Baconaua best film of 2017". Retrieved December 4, 2018. "Winners!
Noel_Comia_Jr.
YCC
YCC
YCC
YCC
YCC
YCC
Acronyms & AI meanings
plasma soluble lipofuscins
Execution Unit CPU
Driver Seat Module
Committee to Save Merry Christmas
High Risk Approach
Foo Of Oberlin
Electron Beam Imaging System
Academic Staff Union of Polytechnics
Centre for German Jewish Studies
: Aging of Veterans of the Union Army
YCC
YCC
YCC
YCC
YCC